circad | circRNAs associated with diseases

CircHMGCS1
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Hepatoblastoma	ICD-10	Hepatoblastoma (C22.2)
DBLink	Link to database	PMID	30809316
Experimental Method
Sample Type	Tissue and cell lines	Comparison	5 paired HB and matched normal tissue samples
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCTAGCTCGGATGTTGCTGA Reverse TCAGGCTTGTAAAAATCATAGGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhen, N, Gu, S, Ma, J, Zhu, J, Yin, M, Xu, M, Wang, J, Huang, N, Cui, Z, Bian, Z, Sun, F, Pan, Q (2019). CircHMGCS1 Promotes Hepatoblastoma Cell Proliferation by Regulating the IGF Signaling Pathway and Glutaminolysis. Theranostics, 9, 3:900-919.